Results of the Genetics Test

As promised (though a little late) here are the details about the genetic testing around Jordan’s hearing loss. I wasn’t all that motivated to write the blog because, well, we don’t have any kind of a clear answer…mostly just more questions. Still, I will do my best to go over what was tested and what we have learned. I won’t give a primer on basic genetics but I will try to keep the language simple. If you want to get a head-start, here are a couple of good links about genetic inheritance and deafness.

This has a readable introduction to inheritance and mutations. The section “What is a Connexin 26 Test?” is also relevant to this post.

http://www.asha.org/Publications/leader/2005/050906/f050906a.htm

This next link opens a pdf document as a slideshow. It covers all kinds of hearing loss, but it does start with a decent primer on inheritance and it does focus on Connexin 26 hearing loss which is what I focus on below.

http://www.infanthearing.org/meeting/ehdi2006/presentations/Rehm_EHDI2006.pdf

For starters, what was tested? Well, back in November 2009 we met with the ENT (Ear-Nose-Throat aka an Otolaryngologist) specialist who gave us the requisition to have blood drawn and sent for genetic testing. Jordan had the blood drawn that day…and 10 months later we went for the results. The specific test they ran was to look at the two most common causes of genetic hearing loss.

One is on a gene called GJB2 which stands for Gap Junction Beta 2 and this gene contains the genetic code for a protein called Connexin 26. The other is gene GJB3 coding for Connexin 30. OK, what does this all mean? Well, in the cochlea of the inner ear one of the key steps in hearing is when the mechanical wave of sound going through the fluid of the inner ear moves some tiny hair cells which in turn create an electrical signal and that signal is sent to the brain for processing…that is when you hear. The details are complex but part of conducting the electrical signal requires the movement of potassium ions through this structure. The cell wall membrane prevents the flow of potassium between cells, so small structures call Gap Junctions exist to create a kind of tunnel through the membranes to permit the potassium flow. Here is a schematic of this using the Connexin 26 proteins to create the tunnel between cells:

It’s easy to imagine that if a person had no Gap Junctions or if the tunnels were deformed in some way, the potassium ions would not flow properly and the electrical signal would be stopped or degraded: the person would be deaf or hard-of-hearing.

OK, I lied…one bit of genetics 101. We inherit two copies of each gene: one from our father and one from our mother. When the foetus is being built sometimes only one copy is used (if it is a dominant gene), sometimes both are the same and sometimes two different copies are blended together. Either way, when the genetic code is being read, the sequence of G, A, T and C are read in groups of 3 to make an amino acid, and the group of amino acids go together to build a protein.

In Jordan’s case, when they looked at his genes for the Connexin 26 protein they found that on ONE copy, one single base was switched. At position 11 there should be a “G” but Jordan has an “A”. Here is the actual genetic sequence for Cx26 with Jordan’s mutation:

ATGGATTGGGACACGCTGCAGACGATCCTGGGGGGTGTGAACA
AACACTCCACCAGCATTGGAAAGATCTGGCTCACCGTCCTCTTC
ATTTTTCGCATTATGATCCTCGTTGTGGCTGCAAAGGAGGTGTG
GGGAGATGAGCAGGCCGACTTTGTCTGCAACACCCTGCAGCCA
GGCTGCAAGAACGTGTGCTACGATCACTACTTCCCCATCTCCCA
CATCCGGCTATGGGCCCTGCAGCTGATCTTCGTGTCCAGCCCA
GCGCTCCTAGTGGCCATGCACGTGGCCTACCGGAGACATGAGA
AGAAGAGGAAGTTCATCAAGGGGGAGATAAAGAGTGAATTTAAG
GACATCGAGGAGATCAAAACCCAGAAGGTCCGCATCGAAGGCT
CCCTGTGGTGGACCTACACAAGCAGCATCTTCTTCCGGGTCATC
TTCGAAGCCGCCTTCATGTACGTCTTCTATGTCATGTACGACGG
CTTCTCCATGCAGCGGCTGGTGAAGTGCAACGCCTGGCCTTGT
CCCAACACTGTGGACTGCTTTGTGTCCCGGCCCACGGAGAAGA
CTGTCTTCACAGTGTTCATGATTGCAGTGTCTGGAATTTGCATC
CTGCTGAATGTCACTGAATTGTGTTATTTGCTAATTAGATATTGT
TCTGGGAAGTCAAAAAAGCCAGTTTAA

OK, great. So what does this mean? Well, this is where we run out of answers.

First, this particular mutation has never been identified before. So, the hope that it would be a known, well-studied mutation is out the window. Second, the fact that this mutation was found on only one gene adds to the puzzle. Often genetic hearing loss is ‘recessive’ which means if you only have 1 copy of that gene then you don’t get hearing loss – you are a carrier. If Debbie and I were carriers then we would have normal hearing, but in the 25% chance that Jordan inherited this recessive gene from each parent then he would have hearing loss. But that’s not the case since Jordan only has one copy. This means there are three possible scenarios:

• It is possible that this mutation IS recessive and the mutation in Jordan’s other copy of this gene was missed in the testing.
• It is possible that this mutation is dominant and thus doesn’t require another copy. The issue here is that since neither of Jordan’s parents have hearing loss, it would mean that this mutation was NOT inherited and instead was a point-mutation that just happened to Jordan. This is possible, but with a history of hearing loss in Chris’ family, this seems unlikely.
• It is possible that this mutation means nothing and that Jordan’s hearing loss is due to another genetic cause (there are hundreds of known mutations for hearing loss across dozens of genes…and probably hundreds more not yet identified) or due to a non-genetic environmental cause.

So, in some ways we are back at square 1. We have identified a mutation in one copy of Jordan’s Cx26 gene but it may or may not be the cause of his hearing loss. Not that this is a huge deal; it would be nice to be able to say “Jordan has such-and-such a mutation which is known,” because we’d know if his hearing loss could change over his lifetime or if he could have any other medical issues as a result of this mutation. But not knowing is the same position that any of us are in so Jordan is no different.

What are the next steps? Well, the doctor did another blood test, this time for mitochondrial DNA. Mitochondria are important parts of the cells in your body and they have their own DNA – which is ONLY inherited from the mother. The doctor wants to check the mitochondrial DNA for known hearing loss mutations there. Again, it is possible but with a history of hearing loss on Chris’ side of the family this feels a bit more like a stretch.

The doctor also recommended a cranial CT scan for Jordan – the idea is that they can look at the structure of the inner ear and potentially identify a cause (genetic or not) that way. Chris is still a little hesitant to subject Jordan to the radiation of a cranial CT. That decision has not yet been made…but the thinking is that we will wait until the results of the mitochondrial DNA test come back. If those are positive, then there is no need for the CT scan.

We, of course, will keep you updated as we learn more.

How do you sign "hungry," again?

100% Cutie!

I am not much for New Year’s Resolutions. Several years ago I realized that making a change for the better ought to come from the changee, not Old Man Time closing the file on twelve previous months. Having said this, I have to admit to falling off numerous wagons in the last bit of 2009: the Cloth Diaper Wagon, the Exercise Wagon, and the Hearing Aid Supermom Wagon. It’s time to clamber back on board.

I am very passionate about cloth diapering; I see it as that little bit extra I can do to help out Mamma Nature and it isn’t insanely inconvenient over disposables. No one loves laundry, least of all myself, but all I need to add is an extra rinse cycle to an extra load of wash every other day. So why have I gotten so lazy about this? I am not sure, but I am tackling it with a renewed vigour: days at home are once again cloth diaper days, I’m back at it since last week.

Exercise. Ugh. I was doing so well up until Thanksgiving! When Jordy hit three months I dedicated myself to a regular workout and was back to my pre-baby weight in no time! Hooray. Then I got sick around Thanksgiving and never got back to the regime. Of course, by the time I started feeling really bad about it, it was coming up on Christmas and with all the chocolate and fruitcake, really, what’s the point!? So I am going to dedicate myself to that again, soon, annnnny day now....

The little reacher-creature trying to snag my mocha
during a break on Commercial Drive -- and really,
can you blame him?

Now the Hearing Aid (H.A.) situation is the one I feel most guilty about. Jordan went several days over the Holidays without wearing his H.A.s at all! This is a funny one, because it started out that we would take a break from the H.A.s whenever Jordan was having a “bad H.A. day.” This means pulling them out constantly and crying every single time I would put them back in. Doesn’t sound too bad when I type it out in black and white, but living with it is bloody torture (for both of us, I am sure.) What I noticed after the last time we got new ear molds made up is that he had fewer of these days when the H.A.s fit nice and snug. But then he would have the occasional bad H.A. day (and my theory on why is the old ladies’ excuse for everything: teething. He would pull at his ears even without H.A.s in them.) Anyhow, we had so many bad H.A. days in November that even after we got new ear molds and he was having better H.A. days, I had gotten lazy. Yes, I own that. But I have noticed that it is very easy for not only myself, but for everyone around me to come up with reasons to excuse me for this lapse. It’s too loud, we’re passing the baby around at the party and don’t want to lose the H.A.s, he pulled them out once – let’s take a break, you can’t expect a 6 month old to just accept them without a fight, etc. Until it occurred to me that babies with normal hearing cannot turn down the noise, they have to live with it, and too bad if it isn’t convenient, it’s up to me and Chris to not lose his H.A.s and to try more than once to put them back in if he takes them out, and while it may be true that it is a lot to expect a baby to wear H.A.s without a fight that doesn’t mean we don’t make the effort to put them in every day. When I examined the lame excuses I was using I felt terrible, but I knew this was only a fraction of the guilt I would feel if Jordy has a speech delay that is my fault. Thus I have a new commitment to putting Jordan’s H.A.s in on a daily basis. And though we do sometimes take breaks, they always go back in his little ears. I take this moment to ask friends and family who spend time with us to help us out in this endeavour. Don’t feel weird or bad asking where his H.A.s are or timid because you don’t know how to put his H.A.s in; let me know if you want me to show you how, it really isn’t difficult at all once you know how they go in.

This topic does remind me that I haven’t updated everyone on our new Speech-Language Pathologist (SLP,) Sydelle. Unfortunately, due to some budget cut-backs this fiscal year, DCS had to let go of Ayasha. Though we were extremely sad to see her go, the timing turned out to be okay for her as she was able to find another agency looking for an SLP and as she has a little one due in the spring so she will be going on maternity leave shortly anyhow. Sydelle is fabulous! Chris hasn’t actually met her yet, but both of them keep telling me, “I’ve got to meet this person, he/she sounds (insert positive adjective – usually ‘funny’ or ‘brilliant,’ here )!” Sydelle has a one year-old, Jake, and so has a lot of supportive advice for me and we find we have a lot in common. Right now we are working on awareness of Jordan’s communication methods and appropriate responses to them (e.g., he reaches for a glass of water – how do we respond,) and reinforcing our own spoken communication with visual cues, such as ASL and facial expressions, etc. (it’s time to boob him and then put him down for a nap – what do we say and sign.) It’s amazing what normal, hearing babies pick up in an incidental fashion by overhearing parents on the phone, speaking to one another, and other language in the background. It takes a lot of effort to be cognizant of our communication so that Jordan takes as much as possible from it. It would be helpful if he had his H.A.s in at all times!

Checking out the crazies on the SkyTrain

We are also taking American Sign Language (ASL) lessons. DCS is able to provide us with in-home lessons, an excellent benefit. We’ve been studying since late November. Ritva is our usual mentor, but she has been ‘snowbirding’ in Arizona since Christmas and until she returns in early March we are having our lessons with Bev. Mark and Aida usually come by on those evenings too, which is a plus as Jordy sees them more than anyone other than Mommy and Daddy. We always have a great time, though it’s possible Ritva thinks we’re all alcoholics; since teaching us ‘beer’ and ‘wine’ in our holiday themed lesson, we like to use sentence examples that include those signs: ‘We have dinner together with family – and drink wine,’ etc. Thank goodness Ritva noticed one night that I was using one of our more common signs incorrectly: for months I thought I was signing ‘hungry.’ It’s hard to explain but, you kind of make a c-shape with your hand, and with the fingers toward you and the back of your hand facing away from you, you gesture downwards along your chest, just ONCE. I was making this movement multiple times, thus asking my son if he was, not ‘hungry,’ but ‘horny!’ I still don’t know which was more cringe-worthy: my gaffe, or Ritva (sweet little grandma that she is) telling me what I was REALLY saying!

Next week we will be taking Jordan in for his first hearing test since his diagnosis. He is now physically capable of sitting up and has a full range of head and neck movement which means he is ready for a Visual Reinforcement Audiology (VRA) assessment. Our audiologist, Selma, will sit in a booth and cue tones for Jordan while he sits in my lap in a dimmed room. The tones will come from the right or the left and when he hears one, he will turn his head (hopefully) in the direction the sound originated, this response is rewarded, by Selma with visual reinforcement. I’m given to understand it’s something like a stuffed animal on that side of the room lights up and moves or sings a song or something equally appealing to a baby, though describing it to you, I admit to having an “It’s a Small World Afterall” moment. I am really looking forward to seeing what his results are, not only to be reassured his hearing hasn’t degenerated at all, but also to see how much better his hearing is with the H.A.’s. Naturally, I’ll let you know how that goes next week.

We did hear back from the University of British Columbia (UBC) before Christmas about Dr. Kozak’s referral for genetic tests. Don’t anyone try holding your breath unless you’re a Navy SEAL though; there is a 12 month patient waiting list! As we said before, it’s just another point of information, it doesn’t really change anything, so we’ll let you know what we find when we find it, but that day is far off and we’ve got bigger fish to fry until then. I don’t want to scare anyone, but before that time, The Little Dumer will probably be walking and talking!

Just another good citizen waiting for a bus

It’s hard to believe that in about a week Jordy will be 8 months old! We’ll have to take him in to be weighed again. When we checked on January 4th he was pushing 19 lbs (18 lbs., 14 oz.) Funny enough, people constantly comment on what a big boy he is, but according to the growth index he is average. Chris theorizes that his sparse hair makes him look younger than he actually is and therefore bigger than his perceived age. I was filling out his baby book the other day and there was so much to write! He is able to grasp with his thumb and forefinger, it’s a little clumsy, but he has enough dexterity to get his rice cracker in his mouth! He isn’t crawling yet, but he is really close; he kind of rotates on his tummy to where he wants to go, not the most efficient way, but it works! And he has got a subtle scoot; you sit him down on his bum on the floor and a minute or two later he is two feet away from his starting point. I have seen the future and it involves a lot of baby-proofing! Jordan had first ride on the bus and sky train this week too, we dropped Chris off at work and then went on an errand to shop for his birthday gift. We later met him for lunch and left the car with him so we could take transit home. The hardest part was getting the stroller on and off the little “community” bus, but even that wasn’t too much hassle. Jordy’s just growing and learning so quickly, Chris doesn’t even really think of him so much as a baby as a little boy at this point. That’s a load of bunk though; he’s still a baby to me, dammit!

Specialist Visit & Autumn with Jordy

Sorry everyone, I just haven't felt very motivated to blog lately. I've got no real excuse, it just happens sometimes. We've been having a busy and beautiful fall season though. The leaves are turning gorgeous colours and the temperature has been dropping more and more. We took a little time to get out and take some photos with Jordan amid the autumn splendour.

Last Tuesday was a pretty big day, the day of our long awaited visit to BC Children's Hospital to see Dr. Kozak, an Otolaryngologist - also commonly known as an ENT (ear, nose & throat) specialist. It went pretty much as we expected. First they took down a family medical history, asked some general information questions, had a look at his throat, nose and finally his ears. Turns out his ears were pretty waxy so doctor cleared those up, but did comment that otherwise his outer ear anatomy was pristine. And then he talked to us about his theory as to what is causing Jordan's hearing loss, what the next steps are and what more we may expect to learn. None of the information we gained was any kind of surprise to us at all. Basically, we and the doctor are guessing that Jordan's hearing loss is caused by a bad genetic bounce. Although we do not know all of my family's medical history we do know that there is a history of hearing loss on Chris' maternal grandmother's side. She had a sister who was partially deaf; she had three kids who were hearing impaired also, and one of those daughters has a son with hearing loss. We're guessing it was a recessive gene as there is no other hearing loss in an entire generation, so that recessive gene probably hooked up with another recessive hearing loss gene on my paternal side of the family, resulting in the manifestation of hearing loss in Jordan. I promise I will get Chris to write up a bit on his findings on the specific gene mutation that we think is responsible for Jordan's hearing impairment, as he is much better at explaining it than I am. But briefly: a large proportion of genetic deafness is caused by a mutation in the Connexin26 (Cx26) gene, the mutation impedes the production or maintenance of potassium ions in the cochlea which in turn, inhibits the cochlea's ability to convert sound waves to electrical nerve impulses.... or something like that.

At any rate, Dr. Kozak has ordered for genetic blood tests and is hooking us up with a geneticist to discuss the results. We should hear about that in a couple of months. Though he believes that Jordan's deafness is not associated with any syndromes, he still wants to arrange for an opthamological exam and if the genetics tests do not confirm our suspicions then more than likely Jordy will have to go for a CT scan to ensure there are no hidden craniofacial anomalies. What do we know at this point? We know that Jordan has a congenital, bilateral, non-syndromic sensorineural hearing loss. This means it was present at birth, it affects both ears, at this time we have no concerns about other physical or mental development, and it is a loss in the inner ear which means that it is permanent. What we do not know (or know for sure): Will the hearing loss progress? He says this is relatively rare, but we are to monitor it. What is the likelihood of any possible future little Dumers having hearing loss? He is ordering the genetics tests for this reason as well, we'll know more when we get the results.

In the end, it's good to know what caused the hearing loss but unless we find out we have more to be worried about, we consider it just another point of information. As far as we are concerned, Jordan is just our perfect little guy and we are in no way looking to shake our fists at the gene pool or give any distant relatives the stink-eye.

He really wants to drink that root beer! We got him a sippy cup this weekend to practice on because he has been expressing interest in mugs and cups... our little man is growing up!

It appears Jordy is considering Lee Valley Hardware for those of you on his Christmas list this year!

OMG - he's so damn cute, couldn't you just eat him?! Look at his puppy-dog hat!

getting ready to go into the hay maze (let me tell you, that smile didn't last long! I thought I was going to die of claustrophobia!)

And finally, we're getting ready for Halloween. Tia Aida and Jordy came with me to pick out pumpkins (calabazas en espanol!) and then we came home and decorated the house for a ghoulish gathering next Saturday. Before we left though, we decided to brave the Haunted Hay Maze! No monsters grabbed us or jumped out of corners, but it was dark and scary in there and Mommy only made it out alive with Jordan and Aida's derring-do! Whew!