This has a readable introduction to inheritance and mutations. The section “What is a Connexin 26 Test?” is also relevant to this post.
http://www.asha.org/Publications/leader/2005/050906/f050906a.htm
This next link opens a pdf document as a slideshow. It covers all kinds of hearing loss, but it does start with a decent primer on inheritance and it does focus on Connexin 26 hearing loss which is what I focus on below.
http://www.infanthearing.org/meeting/ehdi2006/presentations/Rehm_EHDI2006.pdf
For starters, what was tested? Well, back in November 2009 we met with the ENT (Ear-Nose-Throat aka an Otolaryngologist) specialist who gave us the requisition to have blood drawn and sent for genetic testing. Jordan had the blood drawn that day…and 10 months later we went for the results. The specific test they ran was to look at the two most common causes of genetic hearing loss.
One is on a gene called GJB2 which stands for Gap Junction Beta 2 and this gene contains the genetic code for a protein called Connexin 26. The other is gene GJB3 coding for Connexin 30. OK, what does this all mean? Well, in the cochlea of the inner ear one of the key steps in hearing is when the mechanical wave of sound going through the fluid of the inner ear moves some tiny hair cells which in turn create an electrical signal and that signal is sent to the brain for processing…that is when you hear. The details are complex but part of conducting the electrical signal requires the movement of potassium ions through this structure. The cell wall membrane prevents the flow of potassium between cells, so small structures call Gap Junctions exist to create a kind of tunnel through the membranes to permit the potassium flow. Here is a schematic of this using the Connexin 26 proteins to create the tunnel between cells:
It’s easy to imagine that if a person had no Gap Junctions or if the tunnels were deformed in some way, the potassium ions would not flow properly and the electrical signal would be stopped or degraded: the person would be deaf or hard-of-hearing.
OK, I lied…one bit of genetics 101. We inherit two copies of each gene: one from our father and one from our mother. When the foetus is being built sometimes only one copy is used (if it is a dominant gene), sometimes both are the same and sometimes two different copies are blended together. Either way, when the genetic code is being read, the sequence of G, A, T and C are read in groups of 3 to make an amino acid, and the group of amino acids go together to build a protein.
In Jordan’s case, when they looked at his genes for the Connexin 26 protein they found that on ONE copy, one single base was switched. At position 11 there should be a “G” but Jordan has an “A”. Here is the actual genetic sequence for Cx26 with Jordan’s mutation:
ATGGATTGGGACACGCTGCAGACGATCCTGGGGGGTGTGAACA
AACACTCCACCAGCATTGGAAAGATCTGGCTCACCGTCCTCTTC
ATTTTTCGCATTATGATCCTCGTTGTGGCTGCAAAGGAGGTGTG
GGGAGATGAGCAGGCCGACTTTGTCTGCAACACCCTGCAGCCA
GGCTGCAAGAACGTGTGCTACGATCACTACTTCCCCATCTCCCA
CATCCGGCTATGGGCCCTGCAGCTGATCTTCGTGTCCAGCCCA
GCGCTCCTAGTGGCCATGCACGTGGCCTACCGGAGACATGAGA
AGAAGAGGAAGTTCATCAAGGGGGAGATAAAGAGTGAATTTAAG
GACATCGAGGAGATCAAAACCCAGAAGGTCCGCATCGAAGGCT
CCCTGTGGTGGACCTACACAAGCAGCATCTTCTTCCGGGTCATC
TTCGAAGCCGCCTTCATGTACGTCTTCTATGTCATGTACGACGG
CTTCTCCATGCAGCGGCTGGTGAAGTGCAACGCCTGGCCTTGT
CCCAACACTGTGGACTGCTTTGTGTCCCGGCCCACGGAGAAGA
CTGTCTTCACAGTGTTCATGATTGCAGTGTCTGGAATTTGCATC
CTGCTGAATGTCACTGAATTGTGTTATTTGCTAATTAGATATTGT
TCTGGGAAGTCAAAAAAGCCAGTTTAA
OK, great. So what does this mean? Well, this is where we run out of answers.
First, this particular mutation has never been identified before. So, the hope that it would be a known, well-studied mutation is out the window. Second, the fact that this mutation was found on only one gene adds to the puzzle. Often genetic hearing loss is ‘recessive’ which means if you only have 1 copy of that gene then you don’t get hearing loss – you are a carrier. If Debbie and I were carriers then we would have normal hearing, but in the 25% chance that Jordan inherited this recessive gene from each parent then he would have hearing loss. But that’s not the case since Jordan only has one copy. This means there are three possible scenarios:
- It is possible that this mutation IS recessive and the mutation in Jordan’s other copy of this gene was missed in the testing.
- It is possible that this mutation is dominant and thus doesn’t require another copy. The issue here is that since neither of Jordan’s parents have hearing loss, it would mean that this mutation was NOT inherited and instead was a point-mutation that just happened to Jordan. This is possible, but with a history of hearing loss in Chris’ family, this seems unlikely.
- It is possible that this mutation means nothing and that Jordan’s hearing loss is due to another genetic cause (there are hundreds of known mutations for hearing loss across dozens of genes…and probably hundreds more not yet identified) or due to a non-genetic environmental cause.
What are the next steps? Well, the doctor did another blood test, this time for mitochondrial DNA. Mitochondria are important parts of the cells in your body and they have their own DNA – which is ONLY inherited from the mother. The doctor wants to check the mitochondrial DNA for known hearing loss mutations there. Again, it is possible but with a history of hearing loss on Chris’ side of the family this feels a bit more like a stretch.
The doctor also recommended a cranial CT scan for Jordan – the idea is that they can look at the structure of the inner ear and potentially identify a cause (genetic or not) that way. Chris is still a little hesitant to subject Jordan to the radiation of a cranial CT. That decision has not yet been made…but the thinking is that we will wait until the results of the mitochondrial DNA test come back. If those are positive, then there is no need for the CT scan.
We, of course, will keep you updated as we learn more.






He really wants to drink that root beer! We got him a sippy cup this weekend to practice on because he has been expressing interest in mugs and cups... our little man is growing up!



