Results of the Genetics Test

As promised (though a little late) here are the details about the genetic testing around Jordan’s hearing loss. I wasn’t all that motivated to write the blog because, well, we don’t have any kind of a clear answer…mostly just more questions. Still, I will do my best to go over what was tested and what we have learned. I won’t give a primer on basic genetics but I will try to keep the language simple. If you want to get a head-start, here are a couple of good links about genetic inheritance and deafness.

This has a readable introduction to inheritance and mutations. The section “What is a Connexin 26 Test?” is also relevant to this post.

http://www.asha.org/Publications/leader/2005/050906/f050906a.htm

This next link opens a pdf document as a slideshow. It covers all kinds of hearing loss, but it does start with a decent primer on inheritance and it does focus on Connexin 26 hearing loss which is what I focus on below.

http://www.infanthearing.org/meeting/ehdi2006/presentations/Rehm_EHDI2006.pdf

For starters, what was tested? Well, back in November 2009 we met with the ENT (Ear-Nose-Throat aka an Otolaryngologist) specialist who gave us the requisition to have blood drawn and sent for genetic testing. Jordan had the blood drawn that day…and 10 months later we went for the results. The specific test they ran was to look at the two most common causes of genetic hearing loss.

One is on a gene called GJB2 which stands for Gap Junction Beta 2 and this gene contains the genetic code for a protein called Connexin 26. The other is gene GJB3 coding for Connexin 30. OK, what does this all mean? Well, in the cochlea of the inner ear one of the key steps in hearing is when the mechanical wave of sound going through the fluid of the inner ear moves some tiny hair cells which in turn create an electrical signal and that signal is sent to the brain for processing…that is when you hear. The details are complex but part of conducting the electrical signal requires the movement of potassium ions through this structure. The cell wall membrane prevents the flow of potassium between cells, so small structures call Gap Junctions exist to create a kind of tunnel through the membranes to permit the potassium flow. Here is a schematic of this using the Connexin 26 proteins to create the tunnel between cells:

It’s easy to imagine that if a person had no Gap Junctions or if the tunnels were deformed in some way, the potassium ions would not flow properly and the electrical signal would be stopped or degraded: the person would be deaf or hard-of-hearing.

OK, I lied…one bit of genetics 101. We inherit two copies of each gene: one from our father and one from our mother. When the foetus is being built sometimes only one copy is used (if it is a dominant gene), sometimes both are the same and sometimes two different copies are blended together. Either way, when the genetic code is being read, the sequence of G, A, T and C are read in groups of 3 to make an amino acid, and the group of amino acids go together to build a protein.

In Jordan’s case, when they looked at his genes for the Connexin 26 protein they found that on ONE copy, one single base was switched. At position 11 there should be a “G” but Jordan has an “A”. Here is the actual genetic sequence for Cx26 with Jordan’s mutation:

ATGGATTGGGACACGCTGCAGACGATCCTGGGGGGTGTGAACA
AACACTCCACCAGCATTGGAAAGATCTGGCTCACCGTCCTCTTC
ATTTTTCGCATTATGATCCTCGTTGTGGCTGCAAAGGAGGTGTG
GGGAGATGAGCAGGCCGACTTTGTCTGCAACACCCTGCAGCCA
GGCTGCAAGAACGTGTGCTACGATCACTACTTCCCCATCTCCCA
CATCCGGCTATGGGCCCTGCAGCTGATCTTCGTGTCCAGCCCA
GCGCTCCTAGTGGCCATGCACGTGGCCTACCGGAGACATGAGA
AGAAGAGGAAGTTCATCAAGGGGGAGATAAAGAGTGAATTTAAG
GACATCGAGGAGATCAAAACCCAGAAGGTCCGCATCGAAGGCT
CCCTGTGGTGGACCTACACAAGCAGCATCTTCTTCCGGGTCATC
TTCGAAGCCGCCTTCATGTACGTCTTCTATGTCATGTACGACGG
CTTCTCCATGCAGCGGCTGGTGAAGTGCAACGCCTGGCCTTGT
CCCAACACTGTGGACTGCTTTGTGTCCCGGCCCACGGAGAAGA
CTGTCTTCACAGTGTTCATGATTGCAGTGTCTGGAATTTGCATC
CTGCTGAATGTCACTGAATTGTGTTATTTGCTAATTAGATATTGT
TCTGGGAAGTCAAAAAAGCCAGTTTAA

OK, great. So what does this mean? Well, this is where we run out of answers.

First, this particular mutation has never been identified before. So, the hope that it would be a known, well-studied mutation is out the window. Second, the fact that this mutation was found on only one gene adds to the puzzle. Often genetic hearing loss is ‘recessive’ which means if you only have 1 copy of that gene then you don’t get hearing loss – you are a carrier. If Debbie and I were carriers then we would have normal hearing, but in the 25% chance that Jordan inherited this recessive gene from each parent then he would have hearing loss. But that’s not the case since Jordan only has one copy. This means there are three possible scenarios:

• It is possible that this mutation IS recessive and the mutation in Jordan’s other copy of this gene was missed in the testing.
• It is possible that this mutation is dominant and thus doesn’t require another copy. The issue here is that since neither of Jordan’s parents have hearing loss, it would mean that this mutation was NOT inherited and instead was a point-mutation that just happened to Jordan. This is possible, but with a history of hearing loss in Chris’ family, this seems unlikely.
• It is possible that this mutation means nothing and that Jordan’s hearing loss is due to another genetic cause (there are hundreds of known mutations for hearing loss across dozens of genes…and probably hundreds more not yet identified) or due to a non-genetic environmental cause.

So, in some ways we are back at square 1. We have identified a mutation in one copy of Jordan’s Cx26 gene but it may or may not be the cause of his hearing loss. Not that this is a huge deal; it would be nice to be able to say “Jordan has such-and-such a mutation which is known,” because we’d know if his hearing loss could change over his lifetime or if he could have any other medical issues as a result of this mutation. But not knowing is the same position that any of us are in so Jordan is no different.

What are the next steps? Well, the doctor did another blood test, this time for mitochondrial DNA. Mitochondria are important parts of the cells in your body and they have their own DNA – which is ONLY inherited from the mother. The doctor wants to check the mitochondrial DNA for known hearing loss mutations there. Again, it is possible but with a history of hearing loss on Chris’ side of the family this feels a bit more like a stretch.

The doctor also recommended a cranial CT scan for Jordan – the idea is that they can look at the structure of the inner ear and potentially identify a cause (genetic or not) that way. Chris is still a little hesitant to subject Jordan to the radiation of a cranial CT. That decision has not yet been made…but the thinking is that we will wait until the results of the mitochondrial DNA test come back. If those are positive, then there is no need for the CT scan.

We, of course, will keep you updated as we learn more.

Specialist Visit & Autumn with Jordy

Sorry everyone, I just haven't felt very motivated to blog lately. I've got no real excuse, it just happens sometimes. We've been having a busy and beautiful fall season though. The leaves are turning gorgeous colours and the temperature has been dropping more and more. We took a little time to get out and take some photos with Jordan amid the autumn splendour.

Last Tuesday was a pretty big day, the day of our long awaited visit to BC Children's Hospital to see Dr. Kozak, an Otolaryngologist - also commonly known as an ENT (ear, nose & throat) specialist. It went pretty much as we expected. First they took down a family medical history, asked some general information questions, had a look at his throat, nose and finally his ears. Turns out his ears were pretty waxy so doctor cleared those up, but did comment that otherwise his outer ear anatomy was pristine. And then he talked to us about his theory as to what is causing Jordan's hearing loss, what the next steps are and what more we may expect to learn. None of the information we gained was any kind of surprise to us at all. Basically, we and the doctor are guessing that Jordan's hearing loss is caused by a bad genetic bounce. Although we do not know all of my family's medical history we do know that there is a history of hearing loss on Chris' maternal grandmother's side. She had a sister who was partially deaf; she had three kids who were hearing impaired also, and one of those daughters has a son with hearing loss. We're guessing it was a recessive gene as there is no other hearing loss in an entire generation, so that recessive gene probably hooked up with another recessive hearing loss gene on my paternal side of the family, resulting in the manifestation of hearing loss in Jordan. I promise I will get Chris to write up a bit on his findings on the specific gene mutation that we think is responsible for Jordan's hearing impairment, as he is much better at explaining it than I am. But briefly: a large proportion of genetic deafness is caused by a mutation in the Connexin26 (Cx26) gene, the mutation impedes the production or maintenance of potassium ions in the cochlea which in turn, inhibits the cochlea's ability to convert sound waves to electrical nerve impulses.... or something like that.

At any rate, Dr. Kozak has ordered for genetic blood tests and is hooking us up with a geneticist to discuss the results. We should hear about that in a couple of months. Though he believes that Jordan's deafness is not associated with any syndromes, he still wants to arrange for an opthamological exam and if the genetics tests do not confirm our suspicions then more than likely Jordy will have to go for a CT scan to ensure there are no hidden craniofacial anomalies. What do we know at this point? We know that Jordan has a congenital, bilateral, non-syndromic sensorineural hearing loss. This means it was present at birth, it affects both ears, at this time we have no concerns about other physical or mental development, and it is a loss in the inner ear which means that it is permanent. What we do not know (or know for sure): Will the hearing loss progress? He says this is relatively rare, but we are to monitor it. What is the likelihood of any possible future little Dumers having hearing loss? He is ordering the genetics tests for this reason as well, we'll know more when we get the results.

In the end, it's good to know what caused the hearing loss but unless we find out we have more to be worried about, we consider it just another point of information. As far as we are concerned, Jordan is just our perfect little guy and we are in no way looking to shake our fists at the gene pool or give any distant relatives the stink-eye.

He really wants to drink that root beer! We got him a sippy cup this weekend to practice on because he has been expressing interest in mugs and cups... our little man is growing up!

It appears Jordy is considering Lee Valley Hardware for those of you on his Christmas list this year!

OMG - he's so damn cute, couldn't you just eat him?! Look at his puppy-dog hat!

getting ready to go into the hay maze (let me tell you, that smile didn't last long! I thought I was going to die of claustrophobia!)

And finally, we're getting ready for Halloween. Tia Aida and Jordy came with me to pick out pumpkins (calabazas en espanol!) and then we came home and decorated the house for a ghoulish gathering next Saturday. Before we left though, we decided to brave the Haunted Hay Maze! No monsters grabbed us or jumped out of corners, but it was dark and scary in there and Mommy only made it out alive with Jordan and Aida's derring-do! Whew!